ID: 1188060062

View in Genome Browser
Species Human (GRCh38)
Location X:25590338-25590360
Sequence CACCCTACCCCCACCAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188060062_1188060071 12 Left 1188060062 X:25590338-25590360 CCTTGGTTGGTGGGGGTAGGGTG No data
Right 1188060071 X:25590373-25590395 CAGGCAGATTGCTTGGGTGAAGG No data
1188060062_1188060067 6 Left 1188060062 X:25590338-25590360 CCTTGGTTGGTGGGGGTAGGGTG No data
Right 1188060067 X:25590367-25590389 AGGCCCCAGGCAGATTGCTTGGG No data
1188060062_1188060066 5 Left 1188060062 X:25590338-25590360 CCTTGGTTGGTGGGGGTAGGGTG No data
Right 1188060066 X:25590366-25590388 TAGGCCCCAGGCAGATTGCTTGG No data
1188060062_1188060064 -7 Left 1188060062 X:25590338-25590360 CCTTGGTTGGTGGGGGTAGGGTG No data
Right 1188060064 X:25590354-25590376 TAGGGTGATCCTTAGGCCCCAGG No data
1188060062_1188060072 13 Left 1188060062 X:25590338-25590360 CCTTGGTTGGTGGGGGTAGGGTG No data
Right 1188060072 X:25590374-25590396 AGGCAGATTGCTTGGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188060062 Original CRISPR CACCCTACCCCCACCAACCA AGG (reversed) Intergenic
No off target data available for this crispr