ID: 1188068831

View in Genome Browser
Species Human (GRCh38)
Location X:25695011-25695033
Sequence CACCACCACCCTAGGCCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188068821_1188068831 25 Left 1188068821 X:25694963-25694985 CCCACTCTTCCCTCCCTTTTCAA No data
Right 1188068831 X:25695011-25695033 CACCACCACCCTAGGCCCTAAGG No data
1188068820_1188068831 29 Left 1188068820 X:25694959-25694981 CCTTCCCACTCTTCCCTCCCTTT 0: 13
1: 113
2: 291
3: 776
4: 3667
Right 1188068831 X:25695011-25695033 CACCACCACCCTAGGCCCTAAGG No data
1188068826_1188068831 12 Left 1188068826 X:25694976-25694998 CCCTTTTCAAAGATAGAGGAGCT No data
Right 1188068831 X:25695011-25695033 CACCACCACCCTAGGCCCTAAGG No data
1188068827_1188068831 11 Left 1188068827 X:25694977-25694999 CCTTTTCAAAGATAGAGGAGCTT No data
Right 1188068831 X:25695011-25695033 CACCACCACCCTAGGCCCTAAGG No data
1188068825_1188068831 15 Left 1188068825 X:25694973-25694995 CCTCCCTTTTCAAAGATAGAGGA No data
Right 1188068831 X:25695011-25695033 CACCACCACCCTAGGCCCTAAGG No data
1188068823_1188068831 16 Left 1188068823 X:25694972-25694994 CCCTCCCTTTTCAAAGATAGAGG No data
Right 1188068831 X:25695011-25695033 CACCACCACCCTAGGCCCTAAGG No data
1188068822_1188068831 24 Left 1188068822 X:25694964-25694986 CCACTCTTCCCTCCCTTTTCAAA No data
Right 1188068831 X:25695011-25695033 CACCACCACCCTAGGCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188068831 Original CRISPR CACCACCACCCTAGGCCCTA AGG Intergenic
No off target data available for this crispr