ID: 1188071007

View in Genome Browser
Species Human (GRCh38)
Location X:25718276-25718298
Sequence CAGATGTACAAGTGGGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188071000_1188071007 10 Left 1188071000 X:25718243-25718265 CCTGTCATCCTCCTCCTTACACT No data
Right 1188071007 X:25718276-25718298 CAGATGTACAAGTGGGCAAGTGG No data
1188071004_1188071007 -4 Left 1188071004 X:25718257-25718279 CCTTACACTCAAGGTGATGCAGA No data
Right 1188071007 X:25718276-25718298 CAGATGTACAAGTGGGCAAGTGG No data
1188071002_1188071007 2 Left 1188071002 X:25718251-25718273 CCTCCTCCTTACACTCAAGGTGA No data
Right 1188071007 X:25718276-25718298 CAGATGTACAAGTGGGCAAGTGG No data
1188071003_1188071007 -1 Left 1188071003 X:25718254-25718276 CCTCCTTACACTCAAGGTGATGC No data
Right 1188071007 X:25718276-25718298 CAGATGTACAAGTGGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188071007 Original CRISPR CAGATGTACAAGTGGGCAAG TGG Intergenic
No off target data available for this crispr