ID: 1188089189

View in Genome Browser
Species Human (GRCh38)
Location X:25941295-25941317
Sequence GATGAAATGCAGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188089184_1188089189 23 Left 1188089184 X:25941249-25941271 CCAGTTGAGAGATGATTAGCAAT No data
Right 1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188089189 Original CRISPR GATGAAATGCAGAAGGTGGA TGG Intergenic
No off target data available for this crispr