ID: 1188091631

View in Genome Browser
Species Human (GRCh38)
Location X:25971482-25971504
Sequence CTGTGATCACAGACGATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188091631_1188091632 -10 Left 1188091631 X:25971482-25971504 CCAAGCATCGTCTGTGATCACAG No data
Right 1188091632 X:25971495-25971517 GTGATCACAGTGAACAAAAATGG No data
1188091631_1188091633 7 Left 1188091631 X:25971482-25971504 CCAAGCATCGTCTGTGATCACAG No data
Right 1188091633 X:25971512-25971534 AAATGGAAATCAATACCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188091631 Original CRISPR CTGTGATCACAGACGATGCT TGG (reversed) Intergenic
No off target data available for this crispr