ID: 1188091631 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:25971482-25971504 |
| Sequence | CTGTGATCACAGACGATGCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1188091631_1188091632 | -10 | Left | 1188091631 | X:25971482-25971504 | CCAAGCATCGTCTGTGATCACAG | No data | ||
| Right | 1188091632 | X:25971495-25971517 | GTGATCACAGTGAACAAAAATGG | No data | ||||
| 1188091631_1188091633 | 7 | Left | 1188091631 | X:25971482-25971504 | CCAAGCATCGTCTGTGATCACAG | No data | ||
| Right | 1188091633 | X:25971512-25971534 | AAATGGAAATCAATACCAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1188091631 | Original CRISPR | CTGTGATCACAGACGATGCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||