ID: 1188092393

View in Genome Browser
Species Human (GRCh38)
Location X:25978988-25979010
Sequence CAGACAAAACAAAGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188092388_1188092393 -4 Left 1188092388 X:25978969-25978991 CCCATCTCATGTGCAAAGACAGA No data
Right 1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG No data
1188092389_1188092393 -5 Left 1188092389 X:25978970-25978992 CCATCTCATGTGCAAAGACAGAC No data
Right 1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188092393 Original CRISPR CAGACAAAACAAAGGGATGG AGG Intergenic
No off target data available for this crispr