ID: 1188095865

View in Genome Browser
Species Human (GRCh38)
Location X:26020644-26020666
Sequence GTGTGTGCGCGCGCGTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188095865_1188095867 17 Left 1188095865 X:26020644-26020666 CCCATGCACGCGCGCGCACACAC No data
Right 1188095867 X:26020684-26020706 GAACAAACACAAATGTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188095865 Original CRISPR GTGTGTGCGCGCGCGTGCAT GGG (reversed) Intergenic