ID: 1188096176 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:26025918-26025940 |
| Sequence | AAAGGCTTGGTAATGTCATA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1188096176_1188096179 | 19 | Left | 1188096176 | X:26025918-26025940 | CCATATGACATTACCAAGCCTTT | No data | ||
| Right | 1188096179 | X:26025960-26025982 | GACACAGCAATTCACTTCCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1188096176 | Original CRISPR | AAAGGCTTGGTAATGTCATA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||