ID: 1188096176

View in Genome Browser
Species Human (GRCh38)
Location X:26025918-26025940
Sequence AAAGGCTTGGTAATGTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188096176_1188096179 19 Left 1188096176 X:26025918-26025940 CCATATGACATTACCAAGCCTTT No data
Right 1188096179 X:26025960-26025982 GACACAGCAATTCACTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188096176 Original CRISPR AAAGGCTTGGTAATGTCATA TGG (reversed) Intergenic
No off target data available for this crispr