ID: 1188099160

View in Genome Browser
Species Human (GRCh38)
Location X:26061435-26061457
Sequence ATGCTGATAAAGGGTGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188099152_1188099160 19 Left 1188099152 X:26061393-26061415 CCCAGCTAAAACATCTCTCCTAC No data
Right 1188099160 X:26061435-26061457 ATGCTGATAAAGGGTGGACAGGG No data
1188099153_1188099160 18 Left 1188099153 X:26061394-26061416 CCAGCTAAAACATCTCTCCTACT No data
Right 1188099160 X:26061435-26061457 ATGCTGATAAAGGGTGGACAGGG No data
1188099155_1188099160 -6 Left 1188099155 X:26061418-26061440 CCGTGCATCATAAAGTCATGCTG No data
Right 1188099160 X:26061435-26061457 ATGCTGATAAAGGGTGGACAGGG No data
1188099154_1188099160 1 Left 1188099154 X:26061411-26061433 CCTACTACCGTGCATCATAAAGT No data
Right 1188099160 X:26061435-26061457 ATGCTGATAAAGGGTGGACAGGG No data
1188099151_1188099160 22 Left 1188099151 X:26061390-26061412 CCTCCCAGCTAAAACATCTCTCC No data
Right 1188099160 X:26061435-26061457 ATGCTGATAAAGGGTGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188099160 Original CRISPR ATGCTGATAAAGGGTGGACA GGG Intergenic
No off target data available for this crispr