ID: 1188104426

View in Genome Browser
Species Human (GRCh38)
Location X:26132357-26132379
Sequence GAACTAAGAATGGCCCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188104422_1188104426 8 Left 1188104422 X:26132326-26132348 CCATATGGCAAGGAATGTAGGCA No data
Right 1188104426 X:26132357-26132379 GAACTAAGAATGGCCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188104426 Original CRISPR GAACTAAGAATGGCCCCGCC TGG Intergenic
No off target data available for this crispr