ID: 1188106285

View in Genome Browser
Species Human (GRCh38)
Location X:26151571-26151593
Sequence CCAAAAGTGTTACCTGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188106282_1188106285 19 Left 1188106282 X:26151529-26151551 CCTTCTGGTTTTTCTTCATTCTT No data
Right 1188106285 X:26151571-26151593 CCAAAAGTGTTACCTGTAACAGG No data
1188106283_1188106285 -10 Left 1188106283 X:26151558-26151580 CCAAGTTTCTAAGCCAAAAGTGT No data
Right 1188106285 X:26151571-26151593 CCAAAAGTGTTACCTGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188106285 Original CRISPR CCAAAAGTGTTACCTGTAAC AGG Intergenic
No off target data available for this crispr