ID: 1188106618

View in Genome Browser
Species Human (GRCh38)
Location X:26155182-26155204
Sequence GTAACCTTTTTTGCTGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188106615_1188106618 -10 Left 1188106615 X:26155169-26155191 CCTTCAGTGAATTGTAACCTTTT No data
Right 1188106618 X:26155182-26155204 GTAACCTTTTTTGCTGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188106618 Original CRISPR GTAACCTTTTTTGCTGGTGG AGG Intergenic
No off target data available for this crispr