ID: 1188111162

View in Genome Browser
Species Human (GRCh38)
Location X:26197497-26197519
Sequence CAAGGTAAAGATGCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188111157_1188111162 24 Left 1188111157 X:26197450-26197472 CCTTGAGTCAGTGGAGGGTAGAG No data
Right 1188111162 X:26197497-26197519 CAAGGTAAAGATGCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188111162 Original CRISPR CAAGGTAAAGATGCTGAGGA AGG Intergenic
No off target data available for this crispr