ID: 1188111230

View in Genome Browser
Species Human (GRCh38)
Location X:26197882-26197904
Sequence TCCCTGTGGTAACCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188111230_1188111235 11 Left 1188111230 X:26197882-26197904 CCAGCCTCAGGTTACCACAGGGA No data
Right 1188111235 X:26197916-26197938 TCATGCAAACAGTCAAGCTGAGG No data
1188111230_1188111237 24 Left 1188111230 X:26197882-26197904 CCAGCCTCAGGTTACCACAGGGA No data
Right 1188111237 X:26197929-26197951 CAAGCTGAGGACCGTGAGGATGG No data
1188111230_1188111236 20 Left 1188111230 X:26197882-26197904 CCAGCCTCAGGTTACCACAGGGA No data
Right 1188111236 X:26197925-26197947 CAGTCAAGCTGAGGACCGTGAGG No data
1188111230_1188111238 28 Left 1188111230 X:26197882-26197904 CCAGCCTCAGGTTACCACAGGGA No data
Right 1188111238 X:26197933-26197955 CTGAGGACCGTGAGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188111230 Original CRISPR TCCCTGTGGTAACCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr