ID: 1188120671

View in Genome Browser
Species Human (GRCh38)
Location X:26303295-26303317
Sequence TAAAATCACCACTTCCTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188120671_1188120673 -8 Left 1188120671 X:26303295-26303317 CCCATAAGGAAGTGGTGATTTTA No data
Right 1188120673 X:26303310-26303332 TGATTTTAATATCTGTTATGAGG No data
1188120671_1188120676 2 Left 1188120671 X:26303295-26303317 CCCATAAGGAAGTGGTGATTTTA No data
Right 1188120676 X:26303320-26303342 ATCTGTTATGAGGGGAAAACAGG No data
1188120671_1188120675 -6 Left 1188120671 X:26303295-26303317 CCCATAAGGAAGTGGTGATTTTA No data
Right 1188120675 X:26303312-26303334 ATTTTAATATCTGTTATGAGGGG No data
1188120671_1188120674 -7 Left 1188120671 X:26303295-26303317 CCCATAAGGAAGTGGTGATTTTA No data
Right 1188120674 X:26303311-26303333 GATTTTAATATCTGTTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188120671 Original CRISPR TAAAATCACCACTTCCTTAT GGG (reversed) Intergenic
No off target data available for this crispr