ID: 1188126146

View in Genome Browser
Species Human (GRCh38)
Location X:26372110-26372132
Sequence CAATATGCTCAAATATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188126146_1188126150 18 Left 1188126146 X:26372110-26372132 CCTGGGGATATTTGAGCATATTG No data
Right 1188126150 X:26372151-26372173 TGTTTTGTAAGAACAATTAAAGG No data
1188126146_1188126151 30 Left 1188126146 X:26372110-26372132 CCTGGGGATATTTGAGCATATTG No data
Right 1188126151 X:26372163-26372185 ACAATTAAAGGCACTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188126146 Original CRISPR CAATATGCTCAAATATCCCC AGG (reversed) Intergenic
No off target data available for this crispr