ID: 1188126740

View in Genome Browser
Species Human (GRCh38)
Location X:26377566-26377588
Sequence TAACTCAAATGGTCTAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188126734_1188126740 16 Left 1188126734 X:26377527-26377549 CCATGAGAGTTTACAAATGCCAT No data
Right 1188126740 X:26377566-26377588 TAACTCAAATGGTCTAAAACGGG No data
1188126733_1188126740 17 Left 1188126733 X:26377526-26377548 CCCATGAGAGTTTACAAATGCCA No data
Right 1188126740 X:26377566-26377588 TAACTCAAATGGTCTAAAACGGG No data
1188126732_1188126740 22 Left 1188126732 X:26377521-26377543 CCAGTCCCATGAGAGTTTACAAA No data
Right 1188126740 X:26377566-26377588 TAACTCAAATGGTCTAAAACGGG No data
1188126731_1188126740 26 Left 1188126731 X:26377517-26377539 CCTACCAGTCCCATGAGAGTTTA No data
Right 1188126740 X:26377566-26377588 TAACTCAAATGGTCTAAAACGGG No data
1188126737_1188126740 -3 Left 1188126737 X:26377546-26377568 CCATGGCAGTGTCAGGAAGTTAA No data
Right 1188126740 X:26377566-26377588 TAACTCAAATGGTCTAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188126740 Original CRISPR TAACTCAAATGGTCTAAAAC GGG Intergenic
No off target data available for this crispr