ID: 1188127333

View in Genome Browser
Species Human (GRCh38)
Location X:26385157-26385179
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188127330_1188127333 9 Left 1188127330 X:26385125-26385147 CCAAAAGGAAAATTTTTATTATA No data
Right 1188127333 X:26385157-26385179 CAGGCCAAAGTGAAGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188127333 Original CRISPR CAGGCCAAAGTGAAGTTTTG TGG Intergenic
No off target data available for this crispr