ID: 1188129859

View in Genome Browser
Species Human (GRCh38)
Location X:26418390-26418412
Sequence CAGGTACACCAATTAAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188129854_1188129859 22 Left 1188129854 X:26418345-26418367 CCTGAAGAGCATTTTCCAACTTG 0: 10
1: 74
2: 1364
3: 6271
4: 2457
Right 1188129859 X:26418390-26418412 CAGGTACACCAATTAAATGTAGG No data
1188129856_1188129859 7 Left 1188129856 X:26418360-26418382 CCAACTTGGTTCTATTCTCCTCA No data
Right 1188129859 X:26418390-26418412 CAGGTACACCAATTAAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188129859 Original CRISPR CAGGTACACCAATTAAATGT AGG Intergenic
No off target data available for this crispr