ID: 1188136447

View in Genome Browser
Species Human (GRCh38)
Location X:26499654-26499676
Sequence GTGTTCCCCTTCAAGCTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188136440_1188136447 4 Left 1188136440 X:26499627-26499649 CCACAAAAACCCCCTGGCTATCG No data
Right 1188136447 X:26499654-26499676 GTGTTCCCCTTCAAGCTTTAGGG No data
1188136445_1188136447 -8 Left 1188136445 X:26499639-26499661 CCTGGCTATCGGTTAGTGTTCCC No data
Right 1188136447 X:26499654-26499676 GTGTTCCCCTTCAAGCTTTAGGG No data
1188136438_1188136447 12 Left 1188136438 X:26499619-26499641 CCAAAGGACCACAAAAACCCCCT No data
Right 1188136447 X:26499654-26499676 GTGTTCCCCTTCAAGCTTTAGGG No data
1188136442_1188136447 -5 Left 1188136442 X:26499636-26499658 CCCCCTGGCTATCGGTTAGTGTT No data
Right 1188136447 X:26499654-26499676 GTGTTCCCCTTCAAGCTTTAGGG No data
1188136443_1188136447 -6 Left 1188136443 X:26499637-26499659 CCCCTGGCTATCGGTTAGTGTTC No data
Right 1188136447 X:26499654-26499676 GTGTTCCCCTTCAAGCTTTAGGG No data
1188136444_1188136447 -7 Left 1188136444 X:26499638-26499660 CCCTGGCTATCGGTTAGTGTTCC No data
Right 1188136447 X:26499654-26499676 GTGTTCCCCTTCAAGCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188136447 Original CRISPR GTGTTCCCCTTCAAGCTTTA GGG Intergenic
No off target data available for this crispr