ID: 1188146380

View in Genome Browser
Species Human (GRCh38)
Location X:26618827-26618849
Sequence TAGCAGGGAACCACCCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188146380_1188146381 -10 Left 1188146380 X:26618827-26618849 CCTTGATGGGTGGTTCCCTGCTA No data
Right 1188146381 X:26618840-26618862 TTCCCTGCTACTACCTCCTCAGG No data
1188146380_1188146387 23 Left 1188146380 X:26618827-26618849 CCTTGATGGGTGGTTCCCTGCTA No data
Right 1188146387 X:26618873-26618895 TATTCTCCCTATTTCTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188146380 Original CRISPR TAGCAGGGAACCACCCATCA AGG (reversed) Intergenic
No off target data available for this crispr