ID: 1188148889

View in Genome Browser
Species Human (GRCh38)
Location X:26648448-26648470
Sequence CAGGCCAATAACCCTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188148889_1188148891 15 Left 1188148889 X:26648448-26648470 CCTTCATCAGGGTTATTGGCCTG No data
Right 1188148891 X:26648486-26648508 GTTGTATCTGTGTCAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188148889 Original CRISPR CAGGCCAATAACCCTGATGA AGG (reversed) Intergenic
No off target data available for this crispr