ID: 1188156399

View in Genome Browser
Species Human (GRCh38)
Location X:26748296-26748318
Sequence CTGGAGAAGGAGGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188156385_1188156399 21 Left 1188156385 X:26748252-26748274 CCACCACAACTCCAGGAAGGAAA 0: 4
1: 2
2: 7
3: 39
4: 290
Right 1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG No data
1188156391_1188156399 -2 Left 1188156391 X:26748275-26748297 CCAAGGGGCAGACCCAAAAAACT 0: 4
1: 2
2: 1
3: 8
4: 124
Right 1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG No data
1188156390_1188156399 10 Left 1188156390 X:26748263-26748285 CCAGGAAGGAAACCAAGGGGCAG 0: 5
1: 1
2: 1
3: 41
4: 336
Right 1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG No data
1188156382_1188156399 30 Left 1188156382 X:26748243-26748265 CCTGGAAAACCACCACAACTCCA 0: 2
1: 3
2: 2
3: 30
4: 260
Right 1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG No data
1188156386_1188156399 18 Left 1188156386 X:26748255-26748277 CCACAACTCCAGGAAGGAAACCA 0: 4
1: 2
2: 2
3: 25
4: 286
Right 1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188156399 Original CRISPR CTGGAGAAGGAGGAAGAGGA GGG Intergenic
No off target data available for this crispr