ID: 1188156664

View in Genome Browser
Species Human (GRCh38)
Location X:26749424-26749446
Sequence AGAGTATCTTGGGGGATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188156664_1188156674 -3 Left 1188156664 X:26749424-26749446 CCCATGATCCCCCAAGATACTCT No data
Right 1188156674 X:26749444-26749466 TCTTCATGGAGAAGAGGGGCTGG No data
1188156664_1188156678 13 Left 1188156664 X:26749424-26749446 CCCATGATCCCCCAAGATACTCT No data
Right 1188156678 X:26749460-26749482 GGGCTGGAGCATGGCTGGCTGGG No data
1188156664_1188156677 12 Left 1188156664 X:26749424-26749446 CCCATGATCCCCCAAGATACTCT No data
Right 1188156677 X:26749459-26749481 GGGGCTGGAGCATGGCTGGCTGG No data
1188156664_1188156676 8 Left 1188156664 X:26749424-26749446 CCCATGATCCCCCAAGATACTCT No data
Right 1188156676 X:26749455-26749477 AAGAGGGGCTGGAGCATGGCTGG No data
1188156664_1188156675 4 Left 1188156664 X:26749424-26749446 CCCATGATCCCCCAAGATACTCT No data
Right 1188156675 X:26749451-26749473 GGAGAAGAGGGGCTGGAGCATGG No data
1188156664_1188156673 -7 Left 1188156664 X:26749424-26749446 CCCATGATCCCCCAAGATACTCT No data
Right 1188156673 X:26749440-26749462 ATACTCTTCATGGAGAAGAGGGG No data
1188156664_1188156671 -9 Left 1188156664 X:26749424-26749446 CCCATGATCCCCCAAGATACTCT No data
Right 1188156671 X:26749438-26749460 AGATACTCTTCATGGAGAAGAGG No data
1188156664_1188156672 -8 Left 1188156664 X:26749424-26749446 CCCATGATCCCCCAAGATACTCT No data
Right 1188156672 X:26749439-26749461 GATACTCTTCATGGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188156664 Original CRISPR AGAGTATCTTGGGGGATCAT GGG (reversed) Intergenic
No off target data available for this crispr