ID: 1188157329

View in Genome Browser
Species Human (GRCh38)
Location X:26755991-26756013
Sequence CGGCAAACAGCAGTGGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188157326_1188157329 -6 Left 1188157326 X:26755974-26755996 CCGTGGGTCTGCGAGGGCGGCAA No data
Right 1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG No data
1188157317_1188157329 24 Left 1188157317 X:26755944-26755966 CCTGCCGGATCCAGAGGGGGTGG No data
Right 1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG No data
1188157316_1188157329 25 Left 1188157316 X:26755943-26755965 CCCTGCCGGATCCAGAGGGGGTG No data
Right 1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG No data
1188157320_1188157329 14 Left 1188157320 X:26755954-26755976 CCAGAGGGGGTGGAAGTCAGCCG No data
Right 1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG No data
1188157319_1188157329 20 Left 1188157319 X:26755948-26755970 CCGGATCCAGAGGGGGTGGAAGT No data
Right 1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188157329 Original CRISPR CGGCAAACAGCAGTGGCGGA TGG Intergenic
No off target data available for this crispr