ID: 1188165708

View in Genome Browser
Species Human (GRCh38)
Location X:26860542-26860564
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188165706_1188165708 -8 Left 1188165706 X:26860527-26860549 CCTATGACAAAATTAGGACCCTG No data
Right 1188165708 X:26860542-26860564 GGACCCTGATTAAAAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188165708 Original CRISPR GGACCCTGATTAAAAAAAAT GGG Intergenic