ID: 1188174899

View in Genome Browser
Species Human (GRCh38)
Location X:26977206-26977228
Sequence CCATCGCCAAAAAGAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188174899_1188174902 0 Left 1188174899 X:26977206-26977228 CCTCTTTCTCTTTTTGGCGATGG No data
Right 1188174902 X:26977229-26977251 AGATCATGAAATTCATGGCATGG No data
1188174899_1188174906 19 Left 1188174899 X:26977206-26977228 CCTCTTTCTCTTTTTGGCGATGG No data
Right 1188174906 X:26977248-26977270 ATGGGGAAAGGCCACTGCTATGG No data
1188174899_1188174903 1 Left 1188174899 X:26977206-26977228 CCTCTTTCTCTTTTTGGCGATGG No data
Right 1188174903 X:26977230-26977252 GATCATGAAATTCATGGCATGGG No data
1188174899_1188174901 -5 Left 1188174899 X:26977206-26977228 CCTCTTTCTCTTTTTGGCGATGG No data
Right 1188174901 X:26977224-26977246 GATGGAGATCATGAAATTCATGG No data
1188174899_1188174905 7 Left 1188174899 X:26977206-26977228 CCTCTTTCTCTTTTTGGCGATGG No data
Right 1188174905 X:26977236-26977258 GAAATTCATGGCATGGGGAAAGG No data
1188174899_1188174904 2 Left 1188174899 X:26977206-26977228 CCTCTTTCTCTTTTTGGCGATGG No data
Right 1188174904 X:26977231-26977253 ATCATGAAATTCATGGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188174899 Original CRISPR CCATCGCCAAAAAGAGAAAG AGG (reversed) Intergenic
No off target data available for this crispr