ID: 1188177185 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:27005515-27005537 |
| Sequence | CACAGTAAACATAGGGATGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1188177182_1188177185 | 29 | Left | 1188177182 | X:27005463-27005485 | CCATTGATGGACACTTAGGTTGA | 0: 234 1: 891 2: 2253 3: 3405 4: 3873 |
||
| Right | 1188177185 | X:27005515-27005537 | CACAGTAAACATAGGGATGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1188177185 | Original CRISPR | CACAGTAAACATAGGGATGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||