ID: 1188177185

View in Genome Browser
Species Human (GRCh38)
Location X:27005515-27005537
Sequence CACAGTAAACATAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188177182_1188177185 29 Left 1188177182 X:27005463-27005485 CCATTGATGGACACTTAGGTTGA 0: 234
1: 891
2: 2253
3: 3405
4: 3873
Right 1188177185 X:27005515-27005537 CACAGTAAACATAGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188177185 Original CRISPR CACAGTAAACATAGGGATGA AGG Intergenic
No off target data available for this crispr