ID: 1188179280

View in Genome Browser
Species Human (GRCh38)
Location X:27034308-27034330
Sequence ATCACTTTGATTATATGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188179280_1188179283 3 Left 1188179280 X:27034308-27034330 CCTGTCCATATAATCAAAGTGAT No data
Right 1188179283 X:27034334-27034356 GGATTTTTTGCTCCTTAGTTCGG No data
1188179280_1188179284 14 Left 1188179280 X:27034308-27034330 CCTGTCCATATAATCAAAGTGAT No data
Right 1188179284 X:27034345-27034367 TCCTTAGTTCGGCTAAGTTCCGG No data
1188179280_1188179286 15 Left 1188179280 X:27034308-27034330 CCTGTCCATATAATCAAAGTGAT No data
Right 1188179286 X:27034346-27034368 CCTTAGTTCGGCTAAGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188179280 Original CRISPR ATCACTTTGATTATATGGAC AGG (reversed) Intergenic