ID: 1188179280 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:27034308-27034330 |
| Sequence | ATCACTTTGATTATATGGAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1188179280_1188179283 | 3 | Left | 1188179280 | X:27034308-27034330 | CCTGTCCATATAATCAAAGTGAT | No data | ||
| Right | 1188179283 | X:27034334-27034356 | GGATTTTTTGCTCCTTAGTTCGG | No data | ||||
| 1188179280_1188179286 | 15 | Left | 1188179280 | X:27034308-27034330 | CCTGTCCATATAATCAAAGTGAT | No data | ||
| Right | 1188179286 | X:27034346-27034368 | CCTTAGTTCGGCTAAGTTCCGGG | No data | ||||
| 1188179280_1188179284 | 14 | Left | 1188179280 | X:27034308-27034330 | CCTGTCCATATAATCAAAGTGAT | No data | ||
| Right | 1188179284 | X:27034345-27034367 | TCCTTAGTTCGGCTAAGTTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1188179280 | Original CRISPR | ATCACTTTGATTATATGGAC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||