ID: 1188179281

View in Genome Browser
Species Human (GRCh38)
Location X:27034313-27034335
Sequence CCTGCATCACTTTGATTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188179281_1188179284 9 Left 1188179281 X:27034313-27034335 CCATATAATCAAAGTGATGCAGG No data
Right 1188179284 X:27034345-27034367 TCCTTAGTTCGGCTAAGTTCCGG No data
1188179281_1188179288 29 Left 1188179281 X:27034313-27034335 CCATATAATCAAAGTGATGCAGG No data
Right 1188179288 X:27034365-27034387 CGGGTTCCTGTCTCATGACCAGG No data
1188179281_1188179283 -2 Left 1188179281 X:27034313-27034335 CCATATAATCAAAGTGATGCAGG No data
Right 1188179283 X:27034334-27034356 GGATTTTTTGCTCCTTAGTTCGG No data
1188179281_1188179286 10 Left 1188179281 X:27034313-27034335 CCATATAATCAAAGTGATGCAGG No data
Right 1188179286 X:27034346-27034368 CCTTAGTTCGGCTAAGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188179281 Original CRISPR CCTGCATCACTTTGATTATA TGG (reversed) Intergenic
No off target data available for this crispr