ID: 1188179283 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:27034334-27034356 |
Sequence | GGATTTTTTGCTCCTTAGTT CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1188179280_1188179283 | 3 | Left | 1188179280 | X:27034308-27034330 | CCTGTCCATATAATCAAAGTGAT | No data | ||
Right | 1188179283 | X:27034334-27034356 | GGATTTTTTGCTCCTTAGTTCGG | No data | ||||
1188179281_1188179283 | -2 | Left | 1188179281 | X:27034313-27034335 | CCATATAATCAAAGTGATGCAGG | No data | ||
Right | 1188179283 | X:27034334-27034356 | GGATTTTTTGCTCCTTAGTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1188179283 | Original CRISPR | GGATTTTTTGCTCCTTAGTT CGG | Intergenic | ||