ID: 1188179284

View in Genome Browser
Species Human (GRCh38)
Location X:27034345-27034367
Sequence TCCTTAGTTCGGCTAAGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188179281_1188179284 9 Left 1188179281 X:27034313-27034335 CCATATAATCAAAGTGATGCAGG No data
Right 1188179284 X:27034345-27034367 TCCTTAGTTCGGCTAAGTTCCGG No data
1188179280_1188179284 14 Left 1188179280 X:27034308-27034330 CCTGTCCATATAATCAAAGTGAT No data
Right 1188179284 X:27034345-27034367 TCCTTAGTTCGGCTAAGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188179284 Original CRISPR TCCTTAGTTCGGCTAAGTTC CGG Intergenic
No off target data available for this crispr