ID: 1188179288

View in Genome Browser
Species Human (GRCh38)
Location X:27034365-27034387
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188179285_1188179288 -4 Left 1188179285 X:27034346-27034368 CCTTAGTTCGGCTAAGTTCCGGG No data
Right 1188179288 X:27034365-27034387 CGGGTTCCTGTCTCATGACCAGG No data
1188179281_1188179288 29 Left 1188179281 X:27034313-27034335 CCATATAATCAAAGTGATGCAGG No data
Right 1188179288 X:27034365-27034387 CGGGTTCCTGTCTCATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188179288 Original CRISPR CGGGTTCCTGTCTCATGACC AGG Intergenic