ID: 1188179318

View in Genome Browser
Species Human (GRCh38)
Location X:27034581-27034603
Sequence TCCCATTCCCCCAGTGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188179315_1188179318 9 Left 1188179315 X:27034549-27034571 CCTGCATAAGGCGCAAATTCCTA No data
Right 1188179318 X:27034581-27034603 TCCCATTCCCCCAGTGCATGTGG No data
1188179316_1188179318 -10 Left 1188179316 X:27034568-27034590 CCTAGTGACTCCATCCCATTCCC No data
Right 1188179318 X:27034581-27034603 TCCCATTCCCCCAGTGCATGTGG No data
1188179312_1188179318 22 Left 1188179312 X:27034536-27034558 CCAGGCTCCATCTCCTGCATAAG No data
Right 1188179318 X:27034581-27034603 TCCCATTCCCCCAGTGCATGTGG No data
1188179314_1188179318 15 Left 1188179314 X:27034543-27034565 CCATCTCCTGCATAAGGCGCAAA No data
Right 1188179318 X:27034581-27034603 TCCCATTCCCCCAGTGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188179318 Original CRISPR TCCCATTCCCCCAGTGCATG TGG Intergenic
No off target data available for this crispr