ID: 1188182731

View in Genome Browser
Species Human (GRCh38)
Location X:27075561-27075583
Sequence ACACTGCTGTCCACAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188182729_1188182731 -6 Left 1188182729 X:27075544-27075566 CCCACTGAGCTGATAACACACTG 0: 24
1: 44
2: 46
3: 61
4: 141
Right 1188182731 X:27075561-27075583 ACACTGCTGTCCACAGACAGAGG No data
1188182726_1188182731 16 Left 1188182726 X:27075522-27075544 CCCCATGCAAAGAGGCAAAGGGC No data
Right 1188182731 X:27075561-27075583 ACACTGCTGTCCACAGACAGAGG No data
1188182730_1188182731 -7 Left 1188182730 X:27075545-27075567 CCACTGAGCTGATAACACACTGC 0: 25
1: 29
2: 22
3: 28
4: 157
Right 1188182731 X:27075561-27075583 ACACTGCTGTCCACAGACAGAGG No data
1188182727_1188182731 15 Left 1188182727 X:27075523-27075545 CCCATGCAAAGAGGCAAAGGGCC No data
Right 1188182731 X:27075561-27075583 ACACTGCTGTCCACAGACAGAGG No data
1188182728_1188182731 14 Left 1188182728 X:27075524-27075546 CCATGCAAAGAGGCAAAGGGCCC No data
Right 1188182731 X:27075561-27075583 ACACTGCTGTCCACAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188182731 Original CRISPR ACACTGCTGTCCACAGACAG AGG Intergenic
No off target data available for this crispr