ID: 1188187551

View in Genome Browser
Species Human (GRCh38)
Location X:27133235-27133257
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188187551_1188187555 -6 Left 1188187551 X:27133235-27133257 CCTTCTCCAGTAATAACCCAGAG No data
Right 1188187555 X:27133252-27133274 CCAGAGAAGTGATTATGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188187551 Original CRISPR CTCTGGGTTATTACTGGAGA AGG (reversed) Intergenic
No off target data available for this crispr