ID: 1188188412

View in Genome Browser
Species Human (GRCh38)
Location X:27144868-27144890
Sequence CCTCCTGGCAGCGTCTCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188188412_1188188420 -8 Left 1188188412 X:27144868-27144890 CCCCCCGAGACGCTGCCAGGAGG No data
Right 1188188420 X:27144883-27144905 CCAGGAGGACGGCATGAAATTGG No data
1188188412_1188188421 2 Left 1188188412 X:27144868-27144890 CCCCCCGAGACGCTGCCAGGAGG No data
Right 1188188421 X:27144893-27144915 GGCATGAAATTGGCTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188188412 Original CRISPR CCTCCTGGCAGCGTCTCGGG GGG (reversed) Intergenic