ID: 1188188420

View in Genome Browser
Species Human (GRCh38)
Location X:27144883-27144905
Sequence CCAGGAGGACGGCATGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188188408_1188188420 23 Left 1188188408 X:27144837-27144859 CCTTCTGGGGCTTCAGGGGTCAT No data
Right 1188188420 X:27144883-27144905 CCAGGAGGACGGCATGAAATTGG No data
1188188415_1188188420 -10 Left 1188188415 X:27144870-27144892 CCCCGAGACGCTGCCAGGAGGAC No data
Right 1188188420 X:27144883-27144905 CCAGGAGGACGGCATGAAATTGG No data
1188188412_1188188420 -8 Left 1188188412 X:27144868-27144890 CCCCCCGAGACGCTGCCAGGAGG No data
Right 1188188420 X:27144883-27144905 CCAGGAGGACGGCATGAAATTGG No data
1188188414_1188188420 -9 Left 1188188414 X:27144869-27144891 CCCCCGAGACGCTGCCAGGAGGA No data
Right 1188188420 X:27144883-27144905 CCAGGAGGACGGCATGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188188420 Original CRISPR CCAGGAGGACGGCATGAAAT TGG Intergenic