ID: 1188188421

View in Genome Browser
Species Human (GRCh38)
Location X:27144893-27144915
Sequence GGCATGAAATTGGCTTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188188415_1188188421 0 Left 1188188415 X:27144870-27144892 CCCCGAGACGCTGCCAGGAGGAC No data
Right 1188188421 X:27144893-27144915 GGCATGAAATTGGCTTCTGCTGG No data
1188188414_1188188421 1 Left 1188188414 X:27144869-27144891 CCCCCGAGACGCTGCCAGGAGGA No data
Right 1188188421 X:27144893-27144915 GGCATGAAATTGGCTTCTGCTGG No data
1188188417_1188188421 -2 Left 1188188417 X:27144872-27144894 CCGAGACGCTGCCAGGAGGACGG No data
Right 1188188421 X:27144893-27144915 GGCATGAAATTGGCTTCTGCTGG No data
1188188412_1188188421 2 Left 1188188412 X:27144868-27144890 CCCCCCGAGACGCTGCCAGGAGG No data
Right 1188188421 X:27144893-27144915 GGCATGAAATTGGCTTCTGCTGG No data
1188188416_1188188421 -1 Left 1188188416 X:27144871-27144893 CCCGAGACGCTGCCAGGAGGACG No data
Right 1188188421 X:27144893-27144915 GGCATGAAATTGGCTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188188421 Original CRISPR GGCATGAAATTGGCTTCTGC TGG Intergenic