ID: 1188192018

View in Genome Browser
Species Human (GRCh38)
Location X:27182899-27182921
Sequence TACCTAGGGTTACCAACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188192013_1188192018 4 Left 1188192013 X:27182872-27182894 CCACAGTAGAATAGAGCACCAGG 0: 26
1: 99
2: 296
3: 568
4: 992
Right 1188192018 X:27182899-27182921 TACCTAGGGTTACCAACTCCAGG No data
1188192012_1188192018 13 Left 1188192012 X:27182863-27182885 CCAGCTCAGCCACAGTAGAATAG 0: 70
1: 352
2: 760
3: 1063
4: 1190
Right 1188192018 X:27182899-27182921 TACCTAGGGTTACCAACTCCAGG No data
1188192011_1188192018 21 Left 1188192011 X:27182855-27182877 CCTGAGTGCCAGCTCAGCCACAG No data
Right 1188192018 X:27182899-27182921 TACCTAGGGTTACCAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188192018 Original CRISPR TACCTAGGGTTACCAACTCC AGG Intergenic
No off target data available for this crispr