ID: 1188193708

View in Genome Browser
Species Human (GRCh38)
Location X:27204206-27204228
Sequence ATATCATTACAGATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188193708_1188193712 27 Left 1188193708 X:27204206-27204228 CCCTACTCCATCTGTAATGATAT No data
Right 1188193712 X:27204256-27204278 GTTTTGTCCACTCTATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188193708 Original CRISPR ATATCATTACAGATGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr