ID: 1188199792

View in Genome Browser
Species Human (GRCh38)
Location X:27283964-27283986
Sequence CCCTGAGATGGCTGGATCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188199786_1188199792 18 Left 1188199786 X:27283923-27283945 CCAGAGCAGTTTTGAAGGCACTT No data
Right 1188199792 X:27283964-27283986 CCCTGAGATGGCTGGATCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188199792 Original CRISPR CCCTGAGATGGCTGGATCCA CGG Intergenic
No off target data available for this crispr