ID: 1188200283

View in Genome Browser
Species Human (GRCh38)
Location X:27287935-27287957
Sequence GATAAGCCCTCTATCAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188200283_1188200291 29 Left 1188200283 X:27287935-27287957 CCAGTATTGATAGAGGGCTTATC No data
Right 1188200291 X:27287987-27288009 TTTCAGTGATGTGTGTAGTTGGG 0: 35
1: 12
2: 0
3: 22
4: 229
1188200283_1188200286 -3 Left 1188200283 X:27287935-27287957 CCAGTATTGATAGAGGGCTTATC No data
Right 1188200286 X:27287955-27287977 ATCTGTAATACGGAGCTGGAAGG No data
1188200283_1188200285 -7 Left 1188200283 X:27287935-27287957 CCAGTATTGATAGAGGGCTTATC No data
Right 1188200285 X:27287951-27287973 GCTTATCTGTAATACGGAGCTGG No data
1188200283_1188200290 28 Left 1188200283 X:27287935-27287957 CCAGTATTGATAGAGGGCTTATC No data
Right 1188200290 X:27287986-27288008 GTTTCAGTGATGTGTGTAGTTGG 0: 40
1: 16
2: 2
3: 13
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188200283 Original CRISPR GATAAGCCCTCTATCAATAC TGG (reversed) Intergenic
No off target data available for this crispr