ID: 1188200286

View in Genome Browser
Species Human (GRCh38)
Location X:27287955-27287977
Sequence ATCTGTAATACGGAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188200283_1188200286 -3 Left 1188200283 X:27287935-27287957 CCAGTATTGATAGAGGGCTTATC No data
Right 1188200286 X:27287955-27287977 ATCTGTAATACGGAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188200286 Original CRISPR ATCTGTAATACGGAGCTGGA AGG Intergenic
No off target data available for this crispr