ID: 1188211275

View in Genome Browser
Species Human (GRCh38)
Location X:27428127-27428149
Sequence CTGTAAGAATCTATTAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188211273_1188211275 -10 Left 1188211273 X:27428114-27428136 CCTGCTTAAGTTCCTGTAAGAAT 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1188211275 X:27428127-27428149 CTGTAAGAATCTATTAAAGTAGG 0: 1
1: 0
2: 1
3: 14
4: 192
1188211272_1188211275 -6 Left 1188211272 X:27428110-27428132 CCATCCTGCTTAAGTTCCTGTAA 0: 1
1: 1
2: 2
3: 14
4: 314
Right 1188211275 X:27428127-27428149 CTGTAAGAATCTATTAAAGTAGG 0: 1
1: 0
2: 1
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188211275 Original CRISPR CTGTAAGAATCTATTAAAGT AGG Intergenic
900072585 1:784610-784632 CTGTTGGAATCTTTTCAAGTTGG - Intergenic
908543530 1:65144013-65144035 TTGTAATAATCTGTTAATGTTGG - Intergenic
909532427 1:76695613-76695635 CTCAAAGAAGCTAGTAAAGTAGG - Intergenic
910315122 1:85873906-85873928 CTTTATGAAGCTATTAAAGTAGG + Intronic
914771088 1:150685748-150685770 CCATAAGAATCTATTCAAGGAGG + Intronic
915103595 1:153517963-153517985 GTGTTATAATCTATTAACGTTGG + Intergenic
917781639 1:178403928-178403950 ATGTAGGAAACTATTAAGGTCGG + Intronic
920914168 1:210246035-210246057 CTGAAAAAATCTAGTAAAATTGG - Exonic
922268167 1:224007534-224007556 CTGTTGGAATCTTTTCAAGTTGG - Intergenic
924041716 1:239990386-239990408 CAGTAAGTATCTATTACATTAGG + Intergenic
1068232394 10:54185550-54185572 CAGTAAGAATATATTTAATTGGG - Intronic
1069506833 10:69006362-69006384 CTGTAATAATTTTTTAATGTTGG + Intronic
1069516128 10:69078708-69078730 CTTTAAAAATCTGTTAAAGGAGG - Intergenic
1072023022 10:91423337-91423359 ATGTTATAATGTATTAAAGTAGG + Intronic
1073164530 10:101433363-101433385 CTGTAAGAATATATAAAAGGGGG + Intronic
1074124849 10:110520353-110520375 CCTTAAGAAACTATTAAAGGGGG - Intergenic
1079373504 11:19871848-19871870 CTCTAAGAATCGCTCAAAGTGGG - Intronic
1079391642 11:20027012-20027034 CTGTAAATGTCGATTAAAGTTGG + Intronic
1080497611 11:32835340-32835362 AAGAAAGAATGTATTAAAGTAGG - Intronic
1080549611 11:33360969-33360991 CTGTCTGAATCTATTACACTGGG + Intergenic
1080958110 11:37125139-37125161 CTGCTAGAATTTATTTAAGTAGG - Intergenic
1080992643 11:37557931-37557953 CTGTGAAAATCTATTTATGTCGG + Intergenic
1083036632 11:59643773-59643795 CTCTAAAAATCTATAAAAATTGG - Intronic
1084667890 11:70586317-70586339 CTGGAAGAATCTTTAAAAGCTGG + Intronic
1084865927 11:72057445-72057467 CTTTAAAAATCAATTAAAGCTGG + Intronic
1086510910 11:87556803-87556825 GTGAAAGAATCTATCAAATTTGG - Intergenic
1087104545 11:94396796-94396818 CAGTAAGAAACTATTAGAGGTGG - Intronic
1087570334 11:99919283-99919305 CTGAAACAATTTCTTAAAGTAGG - Intronic
1087618519 11:100516752-100516774 CTAGAAGAACCTATAAAAGTGGG + Intergenic
1089193753 11:116678564-116678586 CTGTCAGAATTTTTTAAAATGGG - Intergenic
1090148798 11:124359123-124359145 ATGTAAGAATCTATTTAAAGTGG - Intergenic
1090527250 11:127550714-127550736 CTTTAAGAAACTATTCAACTTGG + Intergenic
1093139193 12:15487914-15487936 CTTTATGAATCCATTAAACTCGG + Intronic
1093241688 12:16684653-16684675 CTGTAAGCAGATACTAAAGTAGG - Intergenic
1095705139 12:45228856-45228878 CTCTAAGAATCTTCTAAAATTGG + Intronic
1095882901 12:47157422-47157444 CTGTAAGAAACTTTAAAAATTGG + Intronic
1097639880 12:62167871-62167893 CAGTAAGCATCTTTTCAAGTTGG - Intronic
1097789567 12:63800358-63800380 CAGTAAGAAGCAATGAAAGTAGG + Intronic
1098782408 12:74703658-74703680 CTTTAAAAATATATTAAATTTGG + Intergenic
1099293092 12:80796500-80796522 CTATGGGAATATATTAAAGTTGG + Exonic
1099422399 12:82478196-82478218 ATGTGAGAATCTAGTAAAATAGG - Intronic
1099488574 12:83258186-83258208 CTGTAATACTCTATTAAAGTAGG - Intergenic
1100862359 12:98819645-98819667 CTGTAAGGATGTATTAGAATGGG + Intronic
1100927324 12:99563825-99563847 CAGTAAAAATGTTTTAAAGTGGG - Intronic
1103339043 12:120211594-120211616 GTGTAGAAATCTATCAAAGTCGG + Exonic
1105224670 13:18419822-18419844 CTCTAAGAATGTAATAAATTTGG + Intronic
1107773255 13:43811020-43811042 CCCTAAGCATCTATTAATGTAGG - Intergenic
1108323730 13:49309954-49309976 CTGTAAGTGTCTTTTAGAGTAGG - Exonic
1108396023 13:49992356-49992378 CTGTAAGAATAAAGTAAAATAGG - Intergenic
1109592525 13:64504831-64504853 CTGTAAGAATCTATAATTGATGG + Intergenic
1110316989 13:74120179-74120201 CTGCAAGAAATTATTTAAGTAGG + Intronic
1111626717 13:90797438-90797460 CTGTCAGCATCTATGAAACTGGG - Intergenic
1112484314 13:99806618-99806640 CTGAAATAATCTAATGAAGTAGG - Intronic
1112638092 13:101240450-101240472 ATAGAAGAATCTAGTAAAGTGGG - Intronic
1112770106 13:102785945-102785967 CTGTAAGCATCCATTCAAATAGG + Intronic
1113981416 13:114280207-114280229 CAATAAGAATCTATTATAGATGG + Intergenic
1114404408 14:22442462-22442484 CCCTAAGAATGTATTAAACTTGG - Intergenic
1115185207 14:30680196-30680218 CTTTATGAACCTATTAAACTAGG - Intronic
1115860690 14:37682963-37682985 CGGTAAGAAACTATTTATGTTGG + Intronic
1116063124 14:39948990-39949012 CTGTAAGAATCTATGGTAGTTGG + Intergenic
1116666663 14:47785151-47785173 CTGGAAGAATCAATCAAAGGAGG - Intergenic
1119081063 14:71694127-71694149 TAATAAGAATCTATTAATGTTGG + Intronic
1119673266 14:76535881-76535903 CTGGAAGAATCTACTTTAGTGGG - Intergenic
1120276887 14:82387103-82387125 CTGTAAGAGTTTTTTAATGTAGG + Intergenic
1120292510 14:82593132-82593154 CTTTAAGCAACTCTTAAAGTAGG + Intergenic
1120360607 14:83496809-83496831 CTTTCAGCATCTATTAAAGAAGG + Intergenic
1122188109 14:100017512-100017534 TTGTAAGAAACCAATAAAGTAGG - Intronic
1125043891 15:35223857-35223879 CTGTAAGAAACTGTAATAGTGGG - Intronic
1126373492 15:47971386-47971408 CTGGAAGTGTCTATTAAAGTTGG + Intergenic
1126388108 15:48114943-48114965 CTGTAAGAAACAATGAAAGAGGG + Intergenic
1127455098 15:59149801-59149823 CTTTACCAATCTATAAAAGTAGG - Intronic
1131125989 15:89857275-89857297 CTGTAAGAAGCTCATAAACTAGG - Intronic
1138781180 16:59789593-59789615 ATGGAAGAATCTGTTATAGTTGG - Intergenic
1138964254 16:62064949-62064971 TTTTAGGGATCTATTAAAGTTGG + Intergenic
1144172828 17:12676100-12676122 CTGTAAGTCTTTAATAAAGTAGG + Intronic
1145097642 17:20044768-20044790 CTGTAAAGTTATATTAAAGTGGG + Intronic
1147036356 17:37684495-37684517 CTCAAACAATCTAATAAAGTAGG + Intergenic
1148918629 17:51007475-51007497 ATTTTATAATCTATTAAAGTAGG - Intronic
1149557452 17:57584299-57584321 CTGGAAGAATATAATAAAATAGG + Intronic
1153071804 18:1115108-1115130 CTGTAATACTTTATTTAAGTTGG + Intergenic
1153990941 18:10399842-10399864 CTGTAAATATCTATGAAAATAGG + Intergenic
1154528686 18:15319628-15319650 CTCTAAGAATGTAATAAATTTGG - Intergenic
1156954560 18:42946210-42946232 TTGTAATAATCTCTTAATGTAGG + Intronic
1162330139 19:10023024-10023046 CTTTAAGAATATACAAAAGTTGG - Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
926467587 2:13210474-13210496 CTGGTAGAATTTTTTAAAGTGGG - Intergenic
928760582 2:34576922-34576944 CTGCAAGAGTCTTTTGAAGTAGG - Intergenic
928955865 2:36866680-36866702 CTCTAAGAATTTATTAATCTGGG + Intronic
929658874 2:43762707-43762729 CTGTAAGAAATCATTAAGGTGGG + Intronic
929792490 2:45033936-45033958 CTCAAAGAATCTATTCTAGTTGG + Intergenic
930145648 2:48000917-48000939 CTGTAAGAATCTTTACACGTTGG - Intergenic
933240487 2:79915796-79915818 CTATCAGAATTTATTTAAGTTGG + Intronic
934866539 2:97818954-97818976 GTGTAAGAATCTATTACATTTGG + Intronic
935533496 2:104264401-104264423 CAGTAAGAATCAATAATAGTAGG + Intergenic
935993426 2:108742739-108742761 CTATAAGAACCTTTTAATGTTGG - Intronic
936688398 2:114856112-114856134 ATGTAAGAAAGTATTAAAATTGG + Intronic
938642652 2:133297551-133297573 CTATAAGAACCAACTAAAGTTGG + Intronic
938739311 2:134216096-134216118 CTGTAAGAAGCTGGTAAAGTCGG + Intronic
941010306 2:160292298-160292320 CTATAACAATCTTTTGAAGTAGG - Intronic
941065992 2:160903476-160903498 CTGTAAAAATCTAGTAAAGCTGG + Intergenic
944085449 2:195842309-195842331 CTGGAAGAATCTATAAAATTTGG - Intronic
946118038 2:217480949-217480971 CTATAAAAATCAATTAAATTTGG - Intronic
947037915 2:225880779-225880801 ATGTAAGAAGGTATTAAAGAAGG - Intergenic
947487354 2:230564072-230564094 CTGGCATAATCTTTTAAAGTTGG + Intergenic
1176768722 21:13048883-13048905 CTCTAAGAATGTAATAAATTTGG + Intergenic
1178572169 21:33748932-33748954 ATGAAAGAAGGTATTAAAGTTGG + Intronic
1181159348 22:20948502-20948524 CTGCAAGAACCTTTCAAAGTTGG + Intronic
1181909253 22:26225403-26225425 CTGTCAGAAGCTATTAGACTCGG + Intronic
1182350076 22:29694436-29694458 ATGTGAGAATCTATTAAAATAGG + Intronic
949886979 3:8703233-8703255 CTGTAAGAAACGAATAAAGGGGG + Intronic
950321892 3:12063576-12063598 ATGTAATAATGGATTAAAGTTGG + Intronic
953874024 3:46654499-46654521 CTGTATGATTCTATTAATGACGG + Intergenic
956935249 3:74093663-74093685 CTGAAAGAAGCTAATAAAATAGG + Intergenic
957405510 3:79770685-79770707 CTGTGAACATCTATAAAAGTTGG + Intergenic
959440596 3:106370082-106370104 ATGCTAGAATCTATTAAAATTGG + Intergenic
959640687 3:108629226-108629248 CTGTAAGAATATGATATAGTTGG - Intronic
962838244 3:139208290-139208312 CTGTAAAAATTTATTCAAGATGG + Intronic
964005821 3:151827210-151827232 ATGTAAGAGTTTATTAAAATAGG - Intronic
965653544 3:170959651-170959673 CTGTAAGAATCTCATAAATCAGG - Intergenic
966215720 3:177500261-177500283 CTGTAAGAAGATATTTAGGTTGG + Intergenic
970295670 4:14626820-14626842 ATGAAAGAATTTAATAAAGTAGG - Intergenic
971356074 4:25896346-25896368 CTGTTAGACGCTATTAAAGGTGG + Intronic
971421667 4:26479082-26479104 CTTTAAAAATATTTTAAAGTAGG + Intergenic
973131726 4:46655747-46655769 CTCTAGAAATCTATTATAGTTGG + Intergenic
973677842 4:53284757-53284779 CTGAAACAATTTATTAAAGGGGG + Intronic
974265052 4:59576214-59576236 CAGTAAAAATCTATTAATATTGG - Intergenic
975700822 4:77064331-77064353 CTGTAAAAATATATTATTGTTGG + Intronic
976611958 4:87039770-87039792 CTGCAAAAATCTATTTAAATAGG - Intronic
978708663 4:111749338-111749360 CTGTTAGAGTCTATAAATGTTGG - Intergenic
978728816 4:112000860-112000882 TTGTAAGAATCCTTTGAAGTTGG - Intergenic
979554196 4:122026212-122026234 ATGTTAAAGTCTATTAAAGTTGG + Intergenic
982949353 4:161670107-161670129 CTTTAAAAATATATTAAAGATGG - Intronic
983574453 4:169245853-169245875 TTGGAAGAATCTATTGAAGGTGG - Intronic
983709598 4:170696915-170696937 CTGTAAGAATTTAAAAAAATTGG + Intergenic
984661756 4:182382048-182382070 CTGATAGAATGTATTAAAGAGGG + Intronic
988726898 5:33935600-33935622 CTCTCAGAATACATTAAAGTAGG + Intergenic
990169708 5:53034172-53034194 GTGTAAGAATATATTACAGTTGG - Intronic
991566155 5:68006886-68006908 CTGTAAAACTCCATAAAAGTTGG + Intergenic
991623722 5:68575120-68575142 CTTTTATAATCTATTAAAATTGG + Intergenic
993035688 5:82754933-82754955 CTGTAAGAAACTAGTAGAGGGGG - Intergenic
994316817 5:98342506-98342528 CTGTAAGAATAAGTTAAAGATGG + Intergenic
995187716 5:109289642-109289664 CTGTAAGATGCCATGAAAGTGGG - Intergenic
995553489 5:113303374-113303396 CTGTAAGCTGCAATTAAAGTTGG - Intronic
996886512 5:128361884-128361906 ATTTAAGCATCTATTACAGTGGG + Intronic
999199402 5:149805192-149805214 CTGTGAGAATCCAGCAAAGTGGG - Intronic
999616364 5:153428895-153428917 TTGTAAGAATTCATTAAAGTTGG - Intergenic
1000665795 5:163994760-163994782 CTGTAAGAAACTTTTCAAGAGGG + Intergenic
1000892381 5:166815250-166815272 CAGTAAGAATATAAAAAAGTGGG - Intergenic
1001145587 5:169181439-169181461 CTTTAAAAAATTATTAAAGTTGG + Intronic
1007296113 6:40822168-40822190 CTCTAAGAATCTGTTAATGGTGG + Intergenic
1008440703 6:51529009-51529031 CTGTTAGACTCTTGTAAAGTGGG - Intergenic
1011997502 6:93611397-93611419 TTGTAAGAACTTTTTAAAGTTGG + Intergenic
1012054589 6:94389632-94389654 CTGCAAGAATTTAGTCAAGTAGG - Intergenic
1012875092 6:104717016-104717038 TTGTGATCATCTATTAAAGTTGG + Intergenic
1013725025 6:113084348-113084370 CTGGAAAAATCTATTGAAATAGG - Intergenic
1014167716 6:118244727-118244749 TTGTAAAAATCTTTGAAAGTGGG + Intronic
1014373698 6:120644352-120644374 ATGAAAGAATAAATTAAAGTTGG - Intergenic
1014660968 6:124171448-124171470 CTTTAAGAATCTATCATAGGAGG - Intronic
1020531510 7:9343459-9343481 CTTTAAAAAGCTATTCAAGTTGG + Intergenic
1020674224 7:11161333-11161355 CTGTCATATTCTATTAAAGAAGG + Intronic
1021410699 7:20327347-20327369 CTGTATTAACCCATTAAAGTAGG + Intergenic
1022048928 7:26646179-26646201 CTGTAATATTCTATAAAAGATGG - Intronic
1022784395 7:33623646-33623668 CAGTAAGAATATATTGAAATTGG - Intergenic
1027543769 7:79500861-79500883 CTGTATAAATATATCAAAGTTGG + Intergenic
1028320333 7:89451423-89451445 CTGTAAGAATAAATTAAAGCAGG + Intergenic
1028465284 7:91144522-91144544 CTGTCTGAATCTATTAAAAATGG - Intronic
1030127753 7:106170750-106170772 TTGTAAGAATCAGTTCAAGTTGG - Intergenic
1030734872 7:113036006-113036028 TTTTAACAATCTAATAAAGTTGG + Intergenic
1030759713 7:113335379-113335401 CTGTAATAAGCTTTTAAATTTGG + Intergenic
1031668375 7:124513721-124513743 CTATATGAAACTATTAAAATAGG - Intergenic
1032364210 7:131284324-131284346 CTATCAGAATCTATGAAAATAGG - Intronic
1033136579 7:138789668-138789690 CTTTAAGAATGTATTAACTTAGG + Intronic
1033823178 7:145158446-145158468 CAATAATTATCTATTAAAGTTGG - Intergenic
1034294547 7:149960502-149960524 CTGAAAGGATGTATTACAGTTGG - Intergenic
1034811511 7:154136352-154136374 CTGAAAGGATGTATTACAGTTGG + Intronic
1035319353 7:158018658-158018680 CTTTAAGAATATAAGAAAGTAGG + Intronic
1037095306 8:14979097-14979119 CTGTAAGAAAATAGTAAACTTGG - Intronic
1037306642 8:17511725-17511747 CTGTTAGAAGCTAATAAACTGGG + Intronic
1037737506 8:21579421-21579443 CCGTAAGAAACAATCAAAGTTGG - Intergenic
1039176125 8:34808392-34808414 TTGTACGAGTCTATTAAATTCGG + Intergenic
1039776327 8:40740915-40740937 CTTGAAGAATCTATTTCAGTGGG + Intronic
1039776482 8:40742664-40742686 CTTGAAGAATCTATTTCAGTGGG + Intronic
1040399862 8:47038929-47038951 CCCTAAAAATCTATTAGAGTTGG + Intergenic
1042141732 8:65686007-65686029 CAGTCAGGAACTATTAAAGTGGG + Intronic
1042265512 8:66905040-66905062 CTGGAACAGTCTATTTAAGTCGG + Intronic
1043680211 8:83014470-83014492 ATGTATGAATCTTTTAAAGCTGG + Intergenic
1046754617 8:117960416-117960438 CTGGAAGAGTCCATTAAGGTTGG - Intronic
1046774979 8:118154309-118154331 ATACAAGAATCTATTGAAGTGGG - Intergenic
1047839314 8:128733070-128733092 CTGCAAGAAGATATAAAAGTGGG + Intergenic
1049928391 9:431873-431895 CTGGAAGATTCTTATAAAGTTGG - Intronic
1054383015 9:64514703-64514725 CTTTCAGAATCCATGAAAGTTGG - Intergenic
1056139454 9:83661167-83661189 CTGTAAGATTCTATACAATTAGG + Exonic
1056362275 9:85870755-85870777 CAGTGAAAGTCTATTAAAGTTGG + Intergenic
1186010126 X:5121328-5121350 ATGTTACAATCTATTAAAATAGG - Intergenic
1188211275 X:27428127-27428149 CTGTAAGAATCTATTAAAGTAGG + Intergenic
1190880492 X:54488636-54488658 CTGTAAGTATAGTTTAAAGTCGG - Intronic
1193392338 X:80943482-80943504 CTGTAGTAATCTGTTCAAGTTGG + Intergenic
1194372958 X:93096974-93096996 CTACAAGAACCTATTTAAGTTGG - Intergenic
1194589771 X:95785639-95785661 CTGTAAGAATGTATGAAAGCAGG + Intergenic
1196598977 X:117579417-117579439 CTATAAAAATCTATTCAAGGTGG - Intergenic
1196806546 X:119592977-119592999 CAGTAAGAGTCTATTCAAATTGG - Intronic
1196839226 X:119843013-119843035 TTATGAGAATCCATTAAAGTGGG - Intronic
1198332372 X:135633493-135633515 CTGGAAGAATCTAATCCAGTTGG - Intergenic
1198555347 X:137787066-137787088 CTGTAAGATTCCATGAAAGTGGG - Intergenic
1199924393 X:152447401-152447423 CTGTAAGAAATTTTTAAAATGGG + Intronic
1200680994 Y:6211011-6211033 CTACAAGAACCTATTTAAGTTGG - Intergenic
1200957397 Y:8964887-8964909 CTGTCAGAGTTTATTAATGTTGG - Intergenic
1202202093 Y:22363916-22363938 CTGTCAGAATTTATTAATCTTGG - Intronic