ID: 1188215032

View in Genome Browser
Species Human (GRCh38)
Location X:27465327-27465349
Sequence CTTGAACTATACTCTACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188215032_1188215036 14 Left 1188215032 X:27465327-27465349 CCTACAGTAGAGTATAGTTCAAG No data
Right 1188215036 X:27465364-27465386 CAGTACAGCTAAGGCACTTGGGG No data
1188215032_1188215034 12 Left 1188215032 X:27465327-27465349 CCTACAGTAGAGTATAGTTCAAG No data
Right 1188215034 X:27465362-27465384 GACAGTACAGCTAAGGCACTTGG No data
1188215032_1188215033 5 Left 1188215032 X:27465327-27465349 CCTACAGTAGAGTATAGTTCAAG No data
Right 1188215033 X:27465355-27465377 TACTTATGACAGTACAGCTAAGG No data
1188215032_1188215035 13 Left 1188215032 X:27465327-27465349 CCTACAGTAGAGTATAGTTCAAG No data
Right 1188215035 X:27465363-27465385 ACAGTACAGCTAAGGCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188215032 Original CRISPR CTTGAACTATACTCTACTGT AGG (reversed) Intergenic