ID: 1188215032 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:27465327-27465349 |
| Sequence | CTTGAACTATACTCTACTGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1188215032_1188215036 | 14 | Left | 1188215032 | X:27465327-27465349 | CCTACAGTAGAGTATAGTTCAAG | No data | ||
| Right | 1188215036 | X:27465364-27465386 | CAGTACAGCTAAGGCACTTGGGG | No data | ||||
| 1188215032_1188215034 | 12 | Left | 1188215032 | X:27465327-27465349 | CCTACAGTAGAGTATAGTTCAAG | No data | ||
| Right | 1188215034 | X:27465362-27465384 | GACAGTACAGCTAAGGCACTTGG | No data | ||||
| 1188215032_1188215033 | 5 | Left | 1188215032 | X:27465327-27465349 | CCTACAGTAGAGTATAGTTCAAG | No data | ||
| Right | 1188215033 | X:27465355-27465377 | TACTTATGACAGTACAGCTAAGG | No data | ||||
| 1188215032_1188215035 | 13 | Left | 1188215032 | X:27465327-27465349 | CCTACAGTAGAGTATAGTTCAAG | No data | ||
| Right | 1188215035 | X:27465363-27465385 | ACAGTACAGCTAAGGCACTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1188215032 | Original CRISPR | CTTGAACTATACTCTACTGT AGG (reversed) | Intergenic | ||