ID: 1188215035

View in Genome Browser
Species Human (GRCh38)
Location X:27465363-27465385
Sequence ACAGTACAGCTAAGGCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188215031_1188215035 30 Left 1188215031 X:27465310-27465332 CCTCTTTTGCAATGTGGCCTACA No data
Right 1188215035 X:27465363-27465385 ACAGTACAGCTAAGGCACTTGGG No data
1188215032_1188215035 13 Left 1188215032 X:27465327-27465349 CCTACAGTAGAGTATAGTTCAAG No data
Right 1188215035 X:27465363-27465385 ACAGTACAGCTAAGGCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188215035 Original CRISPR ACAGTACAGCTAAGGCACTT GGG Intergenic