ID: 1188215036

View in Genome Browser
Species Human (GRCh38)
Location X:27465364-27465386
Sequence CAGTACAGCTAAGGCACTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188215032_1188215036 14 Left 1188215032 X:27465327-27465349 CCTACAGTAGAGTATAGTTCAAG No data
Right 1188215036 X:27465364-27465386 CAGTACAGCTAAGGCACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188215036 Original CRISPR CAGTACAGCTAAGGCACTTG GGG Intergenic