ID: 1188216208

View in Genome Browser
Species Human (GRCh38)
Location X:27480520-27480542
Sequence GCTTCAGGTGGGTCTCTTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188216203_1188216208 -4 Left 1188216203 X:27480501-27480523 CCAGGATAATTTTCTCTCTGCTT No data
Right 1188216208 X:27480520-27480542 GCTTCAGGTGGGTCTCTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188216208 Original CRISPR GCTTCAGGTGGGTCTCTTGG CGG Intergenic
No off target data available for this crispr