ID: 1188220047

View in Genome Browser
Species Human (GRCh38)
Location X:27530360-27530382
Sequence TATAGAAAACAGAAGAATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1188220047_1188220052 28 Left 1188220047 X:27530360-27530382 CCGCCATTCTTCTGTTTTCTATA No data
Right 1188220052 X:27530411-27530433 CCTGTTCCACAAGTATATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1188220047 Original CRISPR TATAGAAAACAGAAGAATGG CGG (reversed) Intergenic
No off target data available for this crispr